I thought I'd cut and paste the summary here so I could refer to it when saying something about it. It is interesting and naturegirl, your daughter's summary is good. ******* Edible fruits, such as that of the tomato plant and other vegetable crops, are markedly diverse in shape and size. SUN, one of the major genes controlling the elongated fruit shape of tomato, was positionally cloned and found to encode a member of the IQ67 domainÂcontaining family. We show that the locus arose as a result of an unusual 24.7-kilobase gene duplication event mediated by the long terminal repeat retrotransposon Rider. This event resulted in a new genomic context that increased SUN expression relative to that of the ancestral copy, culminating in an elongated fruit shape. Our discovery demonstrates that retrotransposons may be a major driving force in genome evolution and gene duplication, resulting in phenotypic change in plants. ***** Basically it's saying that a transposon, which is a movable piece of DNA, sometimes called a jumping gene, can cause duplications in the DNA, such as: Original DNA nucleotide sequence: TTAGTCTAAGCGTAT ( my theoretical sequence) to go to something like: TTAGTCTAAGCGTAT ( duplicate the the terminal sequence b/c the Rider transposon causes terminal, not internal, repeats) So it goes to comething like: TTAGTCTAAGCGTAT(CGTAT) , thus duplicating the CGTAT region at the end so that the sequence becomes: TTAGTCTAAGCTAAGCGTATCGTAT And that DNA duplication when translated to messenger RNA and then expressed as protein can change the shape of a tomato fruit. Jumping genes have been shown to occur almost eveywhere one looks for them in corn and many other veggies, and they're also responsible for several different kinds of antibiotic resistances in bacteria. For those who might have forgotten the nucleotide DNA bases they are: A=adenine T=thymine G=Guanine C=Cytosine So they're suggesting that over time and as tomatoes evolved and were domesticated that different transposons could cause DNA duplications that can alter the tomato genome and cause fruit shape changes and they mention the SUN gene, known to be associated with tomato length, as one example that can be changed by the transposon Rider. Carolyn, who next time she eats a lucious homegrown tomato will NOT be thinking SUN and Rider. LOL

The colors, and way that is done really is beautiful. I like any kind of bird decor, so this was perfect for me. You find some good stuff, Sno. I'm so glad for the eye candy, keeps my nights interesting. LOL hugs, Karen

Color temperature is tougher in decorating because you're working with color in a three-dimensional realm. 99.9% of color information available does not addresses color from a three-dimensional scope. That presents many opportunities to deconstruct color and think about it more truthfully and accurately. Someone suggested I start by selecting a "warm" or "cool" palette to help harmonize the rooms. That's one way to look at. Another is to use that level of contrast. Color is about relationships and to make believe that only the cool colors can play well with other cool colors and warm with warm is not the truth of how color works. It's an easier approach, for sure, but it is by no means the only approach. It could be argued that the rule of thumb of cool with cool and warm with warm really isn't a level of color "harmony" at all -- it just matches. It's the very same with intensity. Keeping to all one intensity or chromatic value room to room isn't THE way to do it. It's just one way to color a house. Juxtaposing a clearer color next to a more muted color can indeed make site lines that are interesting and help define architecture -- it's a way to meet certain expectations. how does dark, old woodwork factor into the warm/cool thing? It's a huge factor. Ya know, I'm always saying that paint does not have to be last, you don't have to have an inspiration piece and *pulling a color* is just one way to look at a color challenge. To say that paint color should always be last is implying that it could be first. Paint color can never be first. Not possible. This is where your woodwork comes into play. Like I said before, color is about relationships and you can start building color relationships once you have the non-transient elements established in the room. The woodwork, the flooring, cabinetry, bookshelves, etc. From those non-transient factors, you can build a shell that will gracefully house whatever contents you want to throw in there. Whatever transient elements you choose are going to "go with" the non transient elements of the room -- the shell. You're not going to choose a sofa that pales off once it's set on your hardwoods. So logically, if you craft the wall color to *harmonize* with the known non-transient elements, you're gonna be fine. It's not necessary to have everything in place to paint a room. Can if ya want, but far too many people put off coloring their environment waiting for that last piece of fluff to be installed. It might be right around the corner -- or it might be years off in the future. Waiting on a *thing* that may or may not ever materialize before you bring color into your experience is a waste of architecture, and time, IMHO. You can color for your now. When it comes to paint color per se, you have to be aware of what "warm" and "cool" really means. In situ undertone and color temperature is revealed when the wall color is juxtaposed to the other colors and elements and exposed to the inherent light in the space. What makes a color "cool" or "warm" is determined when it's experienced in the three-dimensional space it will reside. Outside of that experience, on it's own, whether a color is labeled "warm" or "cool" by some other sets of eyeballs is irrelevant to you and your three-dimensional space. Labeling a paint color as warm or cool can be useful but it's not a fact. It's just a temporary way to organize and categorize paint chips for the preliminary stages of coloring. But the blue-greens, which I thought would give the rooms a sense of peacefulness, actually seem to do the opposite when placed up against the dark reddish wood. I'm guessing it's because of the high contrast? According to your tolerance, it's the opposite of peacefulness. To someone else that playing of contrasts would be a spectacular way to set off, highlight, pay homage to the fabulous woodwork. So for you, a calmer flavor of color harmony would be best. For someone else the amped up vibration of the blue-green to the reddish wood is fabulousness. So to say that keeping an even keel of any level of color contrast is the best way to go about coloring environments would be correct in some instances, but not all. What's the saying....??? even a broken clock is right twice a day.... kinda the same thing.

Check out this thread ... I had bookmarked it. Here is a link that might be useful: Stone advice thread